Keep your phone in your pocket and start capturing the world around you with a new digital camera and cool bundles available on Amazon! You can flex your artistic side, jumpstart your Vlog vids or ...

Meet the LUMIX S1RII, the future of multimedia imaging - Here’s all you need to know about new key features and collaborative ...

Hohem, a global leader in gimbal technology, is delighted to announce its participation in the Photography & Video Show 2025, ...

Its three-axis stabilization ensures ultra-smooth footage, while the detachable remote unlocks creative possibilities — perfect for capturing cinematic angles, group photos, or remote selfies. This ...

This review aims to provide insight into the current concept of the CXCL12/CXCR4 axis in myocardial infarction (MI ... date and hence is less used in studies (Hatse et al., 2005). Box 3.

The primers used for PCR were as follows: 18S forward, 5′-CTCAACACGGGAAACCTCAC-3′; 18S reverse, 5′- CGCTCCACCAACTAAGAACG ... in promoting angiogenesis through the FOXO1/GRHL3/HIF1α axis. Furthermore, ...

This is a light gimbal that runs both Android and iOS and is ideal for new users in videography. 3-Axis Stabilization: It provides stable filming. Easy Switching: Smooth switching between horizontal ...

Additionally, the vivo X200 Ultra will support 4K@120fps HDR video recording and come with a new Live Photo feature and 5-axis stabilization. The smartphone will also feature a new camera mode ...

If sold after 1 year from purchase date, long term capital gain tax will be applicable. Current tax rate is 12.5%, if your total long term capital gain exceeds 1.25 lakh. Any cess/surcharge is not ...

DJI, the global leader in civilian drones and creative camera technology, has launched the Osmo Mobile 7 Series. This new generation of phone gimbal takes three-axis stabilization and intelligent ...

(KJCT) - In light of West Springs' announcement for closure, Axis Health ... 2) Crisis Stabilization Unit: short-term psychiatric care for those in a severe behavioral health crisis. 3) Withdrawal ...